WormMine: Gene WBGene00041825

• WormBase Gene ID: WBGene00041825
• Gene Name: Cbr-twk-14
• Sequence Name: CBG23471
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable potassium channel activity. Predicted to be involved in potassium ion transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans twk-14.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23471a.1	CBG23471a.1		[unknown]
Transcript:CBG23471b.1	CBG23471b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23471b	CBG23471b		[unknown]
CDS:CBG23471a	CBG23471a		[unknown]

0 RNAi Result

11 Allele

• WBVar00027309
• WBVar00133060
• WBVar00133061
• WBVar00133059
• WBVar00133064
• WBVar00133065
• WBVar00133062
• WBVar00133063
• WBVar00027304
• WBVar00133066
• WBVar00133067

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1069606
• Remark: Cbr-twk-14, TGTGGAGAATGAGGAACAGAAGATCTCAGCAACACGAGTAGGACCAATGGGAATTCTTGA, WBGene00041825
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region