WormMine: Gene WBGene00041973

• WormBase Gene ID: WBGene00041973
• Gene Name: Cbr-srg-36
• Sequence Name: CBG23681
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable transmembrane signaling receptor activity. Predicted to be involved in sensory perception of chemical stimulus. Predicted to be located in membrane. Is an ortholog of C. elegans srg-36. In C. elegans, srg-36 is involved in dauer larval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23681.1	CBG23681.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23681	CBG23681		[unknown]

0 RNAi Result

8 Allele

• WBVar00049069
• WBVar00133236
• WBVar00133237
• WBVar00133235
• WBVar00049059
• WBVar00133238
• WBVar00133239
• WBVar00049064

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1057023
• Remark: CBG23681, TTTGTGTGAGAACAAGTGATTCCTACACCGTGTCTTCAGTCAGTCACCAAGTGCAAAACT, WBGene00041973
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region