WormMine: Gene WBGene00041980

• WormBase Gene ID: WBGene00041980
• Gene Name: CBG23695
• Sequence Name: CBG23695
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable nucleic acid binding activity and zinc ion binding activity. Predicted to be involved in DNA-templated transcription and negative regulation of vulval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23695c.1	CBG23695c.1		[unknown]
Transcript:CBG23695b.1	CBG23695b.1		[unknown]
Transcript:CBG23695a.1	CBG23695a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23695c	CBG23695c		[unknown]
CDS:CBG23695a	CBG23695a		[unknown]
CDS:CBG23695b	CBG23695b		[unknown]

0 RNAi Result

1 Allele

• WBVar00049004

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052609
• Remark: CBG23695, GATGGGCGATTTGGTGAATATTGCGAAGAATTTCGATTCGGATTTCACAGAAGATCACTT, WBGene00041980
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region