WormMine: Gene WBGene00041988

• WormBase Gene ID: WBGene00041988
• Gene Name: Cbr-tgt-2
• Sequence Name: CBG23704
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable pentosyltransferase activity. Predicted to be involved in tRNA modification. Is an ortholog of C. elegans tgt-2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23704.1	CBG23704.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23704	CBG23704		[unknown]

0 RNAi Result

20 Allele

• WBVar00133285
• WBVar00133288
• WBVar00021539
• WBVar00133289
• WBVar00133286
• WBVar00053349
• WBVar00133287
• WBVar00133292
• WBVar00133293
• WBVar00021544
• WBVar00133290
• WBVar00133291
• WBVar00133296
• WBVar00133297
• WBVar00133294
• WBVar00133295
• WBVar00021549
• WBVar00133298
• WBVar00021554
• WBVar00021559

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1051231
• Remark: Cbr-tgt-2, GAAATACACGAAGGGCTATCTTCAACACCTTCTGAATACCAAGGAACTTCTGGCGTCGAT, WBGene00041988
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region