WormMine: Gene WBGene00042003

• WormBase Gene ID: WBGene00042003
• Gene Name: CBG23729
• Sequence Name: CBG23729
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be located in mitochondrial inner membrane. Is an ortholog of C. elegans F30F8.9.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23729a.1	CBG23729a.1		[unknown]
Transcript:CBG23729b.1	CBG23729b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23729b	CBG23729b		[unknown]
CDS:CBG23729a	CBG23729a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1064820
• Remark: CBG23729, AGATTGATATTGGCAAGAAAAGCGAGTCGGAAATGCGTGATTCATTACGGCAATATGTCA, WBGene00042003
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region