WormMine: Gene WBGene00042010

• WormBase Gene ID: WBGene00042010
• Gene Name: Cbr-bro-1
• Sequence Name: CBG23739
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable transcription coactivator activity. Predicted to be located in nucleus. Is an ortholog of C. elegans bro-1. In C. elegans, bro-1 is involved in several processes, including negative regulation of transcription by RNA polymerase II; nematode male tail tip morphogenesis; and positive regulation of locomotion involved in locomotory behavior.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23739.1	CBG23739.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23739	CBG23739		[unknown]

0 RNAi Result

2 Allele

• WBVar00044254
• WBVar00044259

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1051176
• Remark: Cbr-bro-1, GAATCATTGGATGGACGCGTCCGATTTGAAAGATTTCAACGTGAGAAGAGTGTGCATCAT, WBGene00042010
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region