WormMine: Gene WBGene00042023

• WormBase Gene ID: WBGene00042023
• Gene Name: Cbr-iars-1
• Sequence Name: CBG23754
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity; aminoacyl-tRNA editing activity; and isoleucine-tRNA ligase activity. Predicted to be involved in isoleucyl-tRNA aminoacylation. Is an ortholog of C. elegans iars-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23754.1	CBG23754.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23754	CBG23754		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1066038
• Remark: Cbr-iars-1, AGGTTGCTGACTACTTGAAGAACAAGGTCACAGAAGCAGAACTAGAGGAGTTCCTTTTGG, WBGene00042023
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

7 GO Annotation

0 Homologues

0 Locations

7 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region