WormMine: Gene WBGene00042044

• WormBase Gene ID: WBGene00042044
• Gene Name: CBG23782
• Sequence Name: CBG23782
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable microtubule binding activity. Is an ortholog of C. elegans F47G4.5. In C. elegans, F47G4.5 is involved in microtubule depolymerization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23782.1	CBG23782.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23782	CBG23782		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062785
• Remark: CBG23782, CTTGATGAGGAATCAGTTGATAGATTGGACGCCACAATGGAGAGATTGAAGAGAATTTGA, WBGene00042044
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region