WormMine: Gene WBGene00042056

• WormBase Gene ID: WBGene00042056
• Gene Name: CBG23794
• Sequence Name: CBG23794
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans Y70G10A.3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23794b.3	CBG23794b.3		[unknown]
Transcript:CBG23794b.2	CBG23794b.2		[unknown]
Transcript:CBG23794b.1	CBG23794b.1		[unknown]
Transcript:CBG23794a.1	CBG23794a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23794b	CBG23794b		[unknown]
CDS:CBG23794a	CBG23794a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063005
• Remark: CBG23794, TTCAGCCATTGTCTGCAAACTTCTCTCAATACTCGCCACAATCATCGGTTATATGACATA, WBGene00042056
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region