WormMine: Gene WBGene00042136

• WormBase Gene ID: WBGene00042136
• Gene Name: Cbr-cand-1
• Sequence Name: CBG23895
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in SCF complex assembly. Is an ortholog of C. elegans cand-1. In C. elegans, cand-1 is involved in regulation of protein deneddylation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23895.1	CBG23895.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23895	CBG23895		[unknown]

0 RNAi Result

4 Allele

• WBVar00015194
• WBVar00015189
• WBVar00133562
• WBVar00133563

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063487
• Remark: Cbr-cand-1, GATTCGCGTTGTGTACATGTTGAAGACAAAATTGCCGGAATTGGAGAGACATCCACAGTA, WBGene00042136
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region