WormMine: Gene WBGene00042197

• WormBase Gene ID: WBGene00042197
• Gene Name: CBG23978
• Sequence Name: CBG23978
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be located in membrane. Is an ortholog of C. elegans Y37H2C.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23978.1	CBG23978.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23978	CBG23978		[unknown]

0 RNAi Result

16 Allele

• WBVar00033754
• WBVar00006074
• WBVar00036797
• WBVar00033759
• WBVar00006079
• WBVar00133602
• WBVar00033764
• WBVar00006084
• WBVar00033769
• WBVar00006089
• WBVar00036782
• WBVar00033774
• WBVar00006094
• WBVar00036787
• WBVar00033779
• WBVar00036792

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
Heat shock: 34C 30min.	Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min.	DESeq2 v 1.18.1, fold change > 2, FDR < 0.01.	WBPaper00058955:heatshock_upregulated_CBG

1 Expression Patterns

• Primary Identifier: Expr1066468
• Remark: CBG23978, AAGTCGTTTGCTTGCTGGGCTGCGTGGCAATGGGAATTCTAGGGATAATAACGAATAACT, WBGene00042197
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region