WormMine: Gene WBGene00042250

• WormBase Gene ID: WBGene00042250
• Gene Name: Cbr-nmad-1
• Sequence Name: CBG24043
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in demethylation. Is an ortholog of C. elegans nmad-1. In C. elegans, nmad-1 is involved in several processes, including meiotic chromosome condensation; positive regulation of double-strand break repair; and positive regulation of reproductive process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG24043.1	CBG24043.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG24043	CBG24043		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1070007
• Remark: CBG24043, CGAGAAGTACGGTGCTGAACTCATTCGTCTGGGAAACATTCGAGTACCACTCAACAAAAC, WBGene00042250
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region