WormMine: Gene WBGene00042282

• WormBase Gene ID: WBGene00042282
• Gene Name: CBG24089
• Sequence Name: CBG24089
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable extracellular ligand-gated monoatomic ion channel activity and transmembrane signaling receptor activity. Predicted to be involved in monoatomic ion transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans deg-3. In C. elegans, deg-3 is involved in positive regulation of locomotion involved in locomotory behavior and regulation of programmed cell death.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG24089.1	CBG24089.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG24089	CBG24089		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054083
• Remark: Cbr-deg-3, AGAAGTGGATGAAATGCGAAGAAAACGACAATGCTCTCTGGAGTGGGAGTTCTTGGCTAC, WBGene00041596
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region