Genomics
1 Transcripts
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
Transcript:CBG24154.1 | CBG24154.1 | [unknown] |
Other
7 Allele
Public Name |
---|
WBVar00133902 |
WBVar00133903 |
WBVar00042144 |
WBVar00013604 |
WBVar00133900 |
WBVar00133901 |
WBVar00013609 |
1 Expression Clusters
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_downregulated |
2 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
CBG24154, CCAGTTGACGCTATTGTCGAAGGACCAAATTTCGAGTATTCTACTGAAACTCACGAAGAA, WBGene00042331 | Expr1065452 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | ||
Cbr-adr-2, CTATGTCTTGCTCAGATAAATTATTGAGAGCCAACGTGTTAGGAGTCCAAGGAGCACTGC, WBGene00042332 | Expr1050886 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |