WormMine: Gene WBGene00042336

• WormBase Gene ID: WBGene00042336
• Gene Name: Cbr-dhhc-8
• Sequence Name: CBG24160
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable palmitoyltransferase activity. Is an ortholog of C. elegans dhhc-8.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG24160b.1	CBG24160b.1		[unknown]
Transcript:CBG24160a.1	CBG24160a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG24160a	CBG24160a		[unknown]
CDS:CBG24160b	CBG24160b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067642
• Remark: CBG24160, GTATTCCATTTGGTTCTAGTGGCACGTGGCAGAACTACAAATGAGCAAGTGACCGGGAAA, WBGene00042336
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region