WormMine: Gene WBGene00042338

• WormBase Gene ID: WBGene00042338
• Gene Name: CBG24164
• Sequence Name: CBG24164
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable cyclin-dependent protein serine/threonine kinase inhibitor activity and snRNA binding activity. Predicted to be involved in negative regulation of transcription by RNA polymerase II. Predicted to be located in cytoplasm and nucleus. Is an ortholog of C. elegans Y39E4B.6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

5 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG24164b.1	CBG24164b.1		[unknown]
Transcript:CBG24164c.2	CBG24164c.2		[unknown]
Transcript:CBG24164c.1	CBG24164c.1		[unknown]
Transcript:CBG24164a.1	CBG24164a.1		[unknown]
Transcript:CBG24164a.2	CBG24164a.2		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG24164c	CBG24164c		[unknown]
CDS:CBG24164a	CBG24164a		[unknown]
CDS:CBG24164b	CBG24164b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060860
• Remark: CBG24164, ATCAACGACGGCGTTACAGTTGAATGCGGTTTCGGCGTCGAAATCGCCGGTTATCGCGAA, WBGene00042338
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region