WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00042415 Gene Name  CBG24260
Sequence Name  ? CBG24260 Organism  Caenorhabditis briggsae
Automated Description  Predicted to enable hydrolase activity. Is an ortholog of C. elegans C23G10.1. In C. elegans, C23G10.1 is involved in defense response to Gram-negative bacterium. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG24260.2 CBG24260.2   [unknown]
Transcript:CBG24260.1 CBG24260.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG24260 CBG24260   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG24261, GGACTCGTCGAGATTGAGGCCGTCGCGATTGCCGGAGAAATCGAAGAAGTTCAAAATTAG, WBGene00042416   Expr1054565 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG24260, TGATACCGGAGGATATCAAAATTCAAGAACGAAAACCGGCGGCCGAGGCAACAGCTGCTG, WBGene00042415   Expr1052265 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  enables

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region