WormMine: Gene WBGene00042489

• WormBase Gene ID: WBGene00042489
• Gene Name: Cbr-tni-3
• Sequence Name: CBG24362
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be part of troponin complex. Is an ortholog of C. elegans tni-3. In C. elegans, tni-3 is involved in egg-laying behavior; muscle contraction; and post-embryonic body morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG24362.1	CBG24362.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG24362	CBG24362		[unknown]

0 RNAi Result

2 Allele

• WBVar00134045
• WBVar00134046

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063716
• Remark: Cbr-tni-3, TGGATGAGATTATGGCCAAGAAGAAGGGACAAACAGGCGATGGTAAACCAGAGTGGTCGA, WBGene00042489
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region