WormMine: Gene WBGene00042676

• WormBase Gene ID: WBGene00042676
• Gene Name: Cbr-ced-9
• Sequence Name: CBG24606
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in regulation of apoptotic process. Is an ortholog of C. elegans ced-9. In C. elegans, ced-9 is involved in several processes, including mitophagy; positive regulation of reproductive process; and regulation of cellular component organization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG24606.1	CBG24606.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG24606	CBG24606		[unknown]

0 RNAi Result

4 Allele

• WBVar00134340
• WBVar00134341
• WBVar00134342
• WBVar00036039

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050458
• Remark: Cbr-ced-9, CAAGTGCGAAACCTTCTTATGTACACATCGCTGTTCATCAAAACGAGAATCCGACAGTCG, WBGene00042676
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region