WormMine: Gene WBGene00042718

• WormBase Gene ID: WBGene00042718
• Gene Name: Cbr-dpf-1
• Sequence Name: CBG24661
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable serine-type peptidase activity. Predicted to be involved in proteolysis. Is an ortholog of C. elegans dpf-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG24661a.1	CBG24661a.1		[unknown]
Transcript:CBG24661b.1	CBG24661b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG24661a	CBG24661a		[unknown]
CDS:CBG24661b	CBG24661b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053637
• Remark: Cbr-dpf-1, CGAACGCTACATGGGTGATGCTCCATTAGAAGCGTACAGTGACGTCACCAAAAAATTGGA, WBGene00042718
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region