WormMine: Gene WBGene00042873

• WormBase Gene ID: WBGene00042873
• Gene Name: Cbr-fzr-1
• Sequence Name: CBG24857
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable anaphase-promoting complex binding activity and ubiquitin-protein transferase activator activity. Is an ortholog of C. elegans fzr-1. In C. elegans, fzr-1 is involved in cell cycle G1/S phase transition and regulation of cell division.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG24857b.1	CBG24857b.1		[unknown]
Transcript:CBG24857a.1	CBG24857a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG24857a	CBG24857a		[unknown]
CDS:CBG24857b	CBG24857b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067252
• Remark: Cbr-fzr-1, TCCGAAAAACCCATATAAAGTGTTGGATGCGCCGGAGTTGCAAGATGATTTCTACCTGAA, WBGene00042873
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region