WormMine: Gene WBGene00042884

• WormBase Gene ID: WBGene00042884
• Gene Name: CBG24871
• Sequence Name: CBG24871
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable pyridoxal phosphate binding activity. Predicted to be involved in transsulfuration. Is an ortholog of C. elegans cbl-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG24871.1	CBG24871.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG24871	CBG24871		[unknown]

0 RNAi Result

9 Allele

• WBVar00134805
• WBVar00134806
• WBVar00134807
• WBVar00134808
• WBVar00037214
• WBVar00037219
• WBVar00037204
• WBVar00037224
• WBVar00037209

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated

1 Expression Patterns

• Primary Identifier: Expr1059097
• Remark: CBG24871, TGCTGGGACCCATTTGATTTGCATGAGTCCAATTTACAGTGGAACATCTTCTTTTATAAA, WBGene00042884
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region