WormMine: Gene WBGene00042956

• WormBase Gene ID: WBGene00042956
• Gene Name: Cbr-eif-3.G.2
• Sequence Name: CBG24970
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable RNA binding activity and translation initiation factor activity. Predicted to be located in cytoplasm. Predicted to be part of eukaryotic translation initiation factor 3 complex. Is an ortholog of C. elegans eif-3.G. In C. elegans, eif-3.G is involved in positive regulation of translation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG24970.1	CBG24970.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG24970	CBG24970		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1051115
• Remark: Cbr-eif-3.G.1, AGCATTGCCGTCACTGCAAAGGAAACGATCACTGGAGCACACATTGTCCGTACAAAGTCA, WBGene00024001
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region