WormMine: Gene WBGene00035644

• WormBase Gene ID: WBGene00035644
• Gene Name: Cbr-hipr-1
• Sequence Name: CBG15345
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable actin binding activity; clathrin binding activity; and phospholipid binding activity. Predicted to be involved in endocytosis. Is an ortholog of C. elegans hipr-1. In C. elegans, hipr-1 is involved in several processes, including defecation; neurotransmitter secretion; and ultradian rhythm.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG15345a.1	CBG15345a.1		[unknown]
Transcript:CBG15345b.1	CBG15345b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG15345a	CBG15345a		[unknown]
CDS:CBG15345b	CBG15345b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067040
• Remark: Cbr-hipr-1, AATCCGCTGATGGAGTTGTCACTGGGAAAGGAAAATTCGAACATTTGATTGTGGCAGCAC, WBGene00035644
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region