WormMine: Gene WBGene00035796

• WormBase Gene ID: WBGene00035796
• Gene Name: CBG15630
• Sequence Name: CBG15630
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable guanyl-nucleotide exchange factor activity and metal ion binding activity. Is an ortholog of C. elegans tag-77.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG15630b.1	CBG15630b.1		[unknown]
Transcript:CBG15630a.1	CBG15630a.1		[unknown]
Transcript:CBG15630c.1	CBG15630c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG15630c	CBG15630c		[unknown]
CDS:CBG15630a	CBG15630a		[unknown]
CDS:CBG15630b	CBG15630b		[unknown]

0 RNAi Result

13 Allele

• WBVar00138264
• WBVar00138263
• WBVar00138266
• WBVar00138265
• WBVar00138268
• WBVar00138267
• WBVar00138269
• WBVar00138271
• WBVar00138270
• WBVar00138273
• WBVar00138272
• WBVar00138275
• WBVar00138274

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054556
• Remark: Cbr-tag-77, TAGTGCAAAGAAGTGGTCGGCTGCGTTCGCTGATAAATTAGAGATGGATCCCACTTTTAA, WBGene00035796
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region