WormMine: Gene WBGene00037417

• WormBase Gene ID: WBGene00037417
• Gene Name: Cbr-nhr-210
• Sequence Name: CBG17906
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA-binding transcription factor activity; sequence-specific DNA binding activity; and zinc ion binding activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans nhr-210.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG17906.1	CBG17906.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG17906	CBG17906		[unknown]

0 RNAi Result

8 Allele

• WBVar00040899
• WBVar00040919
• WBVar00040914
• WBVar00040929
• WBVar00040924
• WBVar00040934
• WBVar00040909
• WBVar00040904

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053964
• Remark: Cbr-nhr-210, GAGGCCAGACCGAGAATGGAGCTGGCGAAAGTGTTTAATTTGATCAAATTGGATTTTTCG, WBGene00037417
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region