WormMine: Gene WBGene00051833

• WormBase Gene ID: WBGene00051833
• Gene Name: Cre-aps-2
• Sequence Name: CRE00817
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable clathrin adaptor activity. Predicted to be involved in clathrin-dependent endocytosis and protein transport. Predicted to be part of AP-2 adaptor complex. Is an ortholog of C. elegans aps-2. In C. elegans, aps-2 is involved in several processes, including body morphogenesis; clathrin-dependent endocytosis; and nematode larval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE00817.1	CRE00817.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE00817	CRE00817		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1108203
• Remark: Cre-aps-2, TCCGTGAAACTTCTCAAACCAAAGTGCTCAAACAGCTTCTGATGCTCACTTCTCTCGAAT, WBGene00051833
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region