WormMine: Gene WBGene00052169

• WormBase Gene ID: WBGene00052169
• Gene Name: Cre-ubh-1
• Sequence Name: CRE31137
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable cysteine-type deubiquitinase activity. Predicted to be involved in ubiquitin-dependent protein catabolic process. Is an ortholog of C. elegans ubh-1. In C. elegans, ubh-1 is involved in negative regulation of dauer larval development; positive regulation of transforming growth factor beta receptor signaling pathway; and protein deneddylation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE31137.1	CRE31137.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE31137	CRE31137		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1113368
• Remark: Cre-ubh-1, CATCTCATCGAGAAACTCGACAATGTCAGCTTCTCTGCGATCGCGCTCGTTGATCAATAA, WBGene00052169
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region