WormMine: Gene WBGene00052221

• WormBase Gene ID: WBGene00052221
• Gene Name: Cre-bbs-8
• Sequence Name: CRE31167
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to be involved in non-motile cilium assembly. Predicted to be part of BBSome. Is an ortholog of C. elegans bbs-8. In C. elegans, bbs-8 is involved in several processes, including cilium organization; olfactory learning; and regulation of cellular localization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE31167.1	CRE31167.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE31167	CRE31167		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1095336
• Remark: Cre-bbs-8, ATCCAAAAATCCTCTGATGTTCGAAGGAAACTATAACTTAGCTCTTGTCTGTGCTGCTCA, WBGene00052221
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region