WormMine: Gene WBGene00052450

• WormBase Gene ID: WBGene00052450
• Gene Name: Cre-dpy-30
• Sequence Name: CRE27063
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to be part of Set1C/COMPASS complex. Is an ortholog of C. elegans dpy-30. In C. elegans, dpy-30 is involved in several processes, including dosage compensation by hypoactivation of X chromosome; nematode male tail tip morphogenesis; and transdifferentiation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE27063.1	CRE27063.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE27063	CRE27063		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1110160
• Remark: Cre-dpy-30, CTCTTGCGCGAGAAGGACCGTTACAACGCGGAGAACCAAAACCCAGCCGGACAACAATAA, WBGene00052450
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region