WormMine: Gene WBGene00052641

• WormBase Gene ID: WBGene00052641
• Gene Name: CRE27482
• Sequence Name: CRE27482
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable RNA binding activity; translation initiation factor activity; and translation initiation factor binding activity. Predicted to be involved in translational initiation. Predicted to be part of eukaryotic translation initiation factor 3 complex. Is an ortholog of C. elegans ZC443.3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE27482.1	CRE27482.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE27482	CRE27482		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1093238
• Remark: CRE27482, GACGAAGATGATTCAGATGACGGAAGTGACATTGAAGAGTTGGAGAAGATTGAGGACAAG, WBGene00052641
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region