WormMine: Gene WBGene00052860

• WormBase Gene ID: WBGene00052860
• Gene Name: Cre-hlh-34
• Sequence Name: CRE05624
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans hlh-34. In C. elegans, hlh-34 is involved in several processes, including nematode pharyngeal pumping; neuron fate specification; and serotonin receptor signaling pathway.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE05624.1	CRE05624.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE05624	CRE05624		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1097687
• Remark: Cre-hlh-34, TTTTCCGTCATACATGTATTTCTTCGAAACAATTCAATGACTCGATCACATTTGTTTCCT, WBGene00052860
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region