WormMine: Gene WBGene00053442

• WormBase Gene ID: WBGene00053442
• Gene Name: Cre-bli-1
• Sequence Name: CRE02193
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to be a structural constituent of cuticle. Is an ortholog of C. elegans bli-1. In C. elegans, bli-1 is involved in cuticle development involved in collagen and cuticulin-based cuticle molting cycle.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE02193.1	CRE02193.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE02193	CRE02193		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1110260
• Remark: Cre-bli-1, AAGAGAAACCAAGACAGGAAGACTCGAGACGATATGCAACTGAATCCGAGCCACTTTACG, WBGene00053442
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region