WormMine: Gene WBGene00053740

• WormBase Gene ID: WBGene00053740
• Gene Name: Cre-let-268
• Sequence Name: CRE02047
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable L-ascorbic acid binding activity; iron ion binding activity; and oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen. Is an ortholog of C. elegans let-268. In C. elegans, let-268 is involved in collagen biosynthetic process and protein glycosylation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE02047.1	CRE02047.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE02047	CRE02047		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1104792
• Remark: Cre-let-268, GAGGGTCTGGCTACCACGAAAGGTACCAGATACATCATGGTGTCATTTATTAACCCATAA, WBGene00053740
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region