WormMine: Gene WBGene00053851

• WormBase Gene ID: WBGene00053851
• Gene Name: Cre-cct-4
• Sequence Name: CRE01986
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable several functions, including ATP binding activity; ATP hydrolysis activity; and ATP-dependent protein folding chaperone. Predicted to be involved in protein folding. Is an ortholog of C. elegans cct-4. In C. elegans, cct-4 is involved in post-embryonic body morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE01986.1	CRE01986.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE01986	CRE01986		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1113079
• Remark: Cre-cct-4, AATGATCAAGATCATCAAGAAGATGGGTGACACTGTTGAAGAATCCGAACTCATCGAGGG, WBGene00053851
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region