WormMine: Gene WBGene00053853

• WormBase Gene ID: WBGene00053853
• Gene Name: Cre-efl-3
• Sequence Name: CRE01589
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Predicted to be part of transcription regulator complex. Is an ortholog of C. elegans efl-3. In C. elegans, efl-3 is involved in negative regulation of gene expression.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE01589.1	CRE01589.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE01589	CRE01589		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1103325
• Remark: CRE01589, CTCGGACTCATAAAAAAGGTGCACTATCTATTTGGAACCAAGAAGATCCCTCTCTTCGTC, WBGene00053853
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region