WormMine: Gene WBGene00053892

• WormBase Gene ID: WBGene00053892
• Gene Name: CRE01961
• Sequence Name: CRE01961
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable calcium channel activity. Predicted to be involved in endoplasmic reticulum calcium ion homeostasis. Predicted to be located in endoplasmic reticulum membrane. Is an ortholog of C. elegans F22B5.10. In C. elegans, F22B5.10 is involved in calcium ion transmembrane transport and endoplasmic reticulum calcium ion homeostasis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE01961.1	CRE01961.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE01961	CRE01961		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1116013
• Remark: CRE01961, TTCATCTTCCTCTACATCTTGTGCACCATGACAGTTCGTCAGAATCTTCAGAAGATTCTT, WBGene00053892
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region