WormMine: Gene WBGene00053965

• WormBase Gene ID: WBGene00053965
• Gene Name: Cre-pyr-1
• Sequence Name: CRE01919
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable several functions, including ATP binding activity; aspartate carbamoyltransferase activity; and carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity. Predicted to be involved in 'de novo' pyrimidine nucleobase biosynthetic process and glutamine metabolic process. Is an ortholog of C. elegans pyr-1. In C. elegans, pyr-1 is involved in several processes, including nematode pharyngeal gland morphogenesis; nematode pharynx development; and pyrimidine nucleobase biosynthetic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE01919.1	CRE01919.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE01919	CRE01919		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1111225
• Remark: Cre-pyr-1, TGAAGGGAAGCTATGTGATCAATGCGAAATTGTTGAACGAAGCAGCCAGAGATGTCGACG, WBGene00053965
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

10 GO Annotation

0 Homologues

0 Locations

10 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region