WormMine: Gene WBGene00053980

• WormBase Gene ID: WBGene00053980
• Gene Name: Cre-vps-35
• Sequence Name: CRE26592
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to be involved in protein transport and retrograde transport, endosome to Golgi. Predicted to be part of retromer, cargo-selective complex. Is an ortholog of C. elegans vps-35. In C. elegans, vps-35 is involved in positive regulation of protein localization to cell periphery; protein localization to postsynaptic membrane; and regulation of presynapse assembly.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE26592.1	CRE26592.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE26592	CRE26592		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1105809
• Remark: Cre-vps-35, AACTTGGAGAAGCGATTAGACGTCTTCAGCTAGCTAAACTTGATGTGGCAGCGTCACAAG, WBGene00053980
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region