WormMine: Gene WBGene00054252

• WormBase Gene ID: WBGene00054252
• Gene Name: Cre-kars-1
• Sequence Name: CRE26182
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable ATP binding activity; lysine-tRNA ligase activity; and nucleic acid binding activity. Predicted to be involved in lysyl-tRNA aminoacylation. Predicted to be located in cytoplasm. Is an ortholog of C. elegans kars-1. In C. elegans, kars-1 is involved in several processes, including determination of adult lifespan; positive regulation of nematode larval development; and regulation of brood size.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE26182.1	CRE26182.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE26182	CRE26182		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1095397
• Remark: Cre-kars-1, AGGGAACTTATAAGATTGAATACCATCCAAACGGCGCCAACACCGAGCCAGTCTACGAAG, WBGene00054252
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

8 GO Annotation

0 Homologues

0 Locations

8 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region