WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00054703 Gene Name  Cre-ogt-1
Sequence Name  ? CRE25383 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Tetratricopeptide repeat; Tetratricopeptide-like helical domain superfamily; O-GlcNAc transferase, C-terminal; UDP-N-acetylglucosamine--peptide N-acetylglucosaminyltransferase 110kDa subunit; Tetratricopeptide repeat 1; TPR repeat; and Glycosyl transferase family 41. Is an ortholog of C. elegans ogt-1. In C. elegans, ogt-1 is involved in several processes, including dauer larval development; glycogen metabolic process; and lipid storage. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE25383.1 CRE25383.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE25383 CRE25383   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-ogt-1, ACAATATTGTCATGACATGGAGGACCTTCTAGATTTAATGTGGAAGCGTTACGAAAGCGG, WBGene00054703   Expr1102636 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  enables
  involved_in

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  enables
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region