WormMine: Gene WBGene00054802

• WormBase Gene ID: WBGene00054802
• Gene Name: Cre-spe-44
• Sequence Name: CRE25435
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable DNA binding activity. Expressed in germ line and in male. Is an ortholog of C. elegans spe-44. In C. elegans, spe-44 is involved in positive regulation of transcription by RNA polymerase II and spermatogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE25435.1	CRE25435.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE25435	CRE25435		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

• Primary Identifier: Expr11707
• Subcellular Localization: Isolated gonads from C. remanei males were immunostained with the anti- SPE-44 antibody (which recognizes a carboxy-terminal epitope whose sequence is conserved among the spe-44 orthologs). As in C. elegans, we observed SPE-44 labeling of the chromatin of pachytene nuclei, with the notable exception of the presumed X chromosome.

• Primary Identifier: Expr1100630
• Remark: Cre-tag-347, CGCTCTTGGAATTCAACCAGTCATTGTTCAACGTGTGCAGTCGATCGAAAGAAATGTGTA, WBGene00054802
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region