WormMine: Gene WBGene00055075

• WormBase Gene ID: WBGene00055075
• Gene Name: Cre-mut-7
• Sequence Name: CRE25295
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable 3'-5' exonuclease activity and nucleic acid binding activity. Predicted to be involved in nucleobase-containing compound metabolic process. Is an ortholog of C. elegans mut-7. In C. elegans, mut-7 is involved in olfactory learning and regulatory ncRNA-mediated post-transcriptional gene silencing.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE25295.1	CRE25295.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE25295	CRE25295		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1098973
• Remark: Cre-mut-7, GAGTGTAATTCACGACTTCAAATCAAGTTCCCAGGACCTGTTCTTCATTTCTTACATCAA, WBGene00055075
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region