WormMine: Gene WBGene00055201

• WormBase Gene ID: WBGene00055201
• Gene Name: CRE12187
• Sequence Name: CRE12187
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable peptide-methionine (R)-S-oxide reductase activity. Predicted to be involved in protein repair and response to oxidative stress. Is an ortholog of C. elegans F44E2.6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE12187.1	CRE12187.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE12187	CRE12187		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1104538
• Remark: CRE12187, AACGATGGGCCAAAGGAGAAAACTGGGGAACGATACTGTATCAACAGTGTGTGTATGGCA, WBGene00055201
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region