WormMine: Gene WBGene00055566

• WormBase Gene ID: WBGene00055566
• Gene Name: CRE04702
• Sequence Name: CRE04702
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable histone deacetylase activity. Is an ortholog of C. elegans hda-1. In C. elegans, hda-1 is involved in several processes, including developmental process involved in reproduction; negative regulation of signal transduction; and regulation of transcription by RNA polymerase II.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE04702.1	CRE04702.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE04702	CRE04702		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1113909
• Remark: CRE04702, ATATCCCATTCAACAACTACTACGAATATTTTGGACCGGATTTTCAACTTCACATCGATC, WBGene00055566
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region