WormMine: Gene WBGene00055588

• WormBase Gene ID: WBGene00055588
• Gene Name: Cre-polq-1.2
• Sequence Name: CRE04524
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable DNA binding activity and DNA-directed DNA polymerase activity. Predicted to be involved in DNA-templated DNA replication. Is an ortholog of C. elegans polq-1. In C. elegans, polq-1 is involved in base-excision repair, gap-filling and cellular response to ionizing radiation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE04524.1	CRE04524.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE04524	CRE04524		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1105915
• Remark: Cre-polq-1, TGGAACTTTTCAAGAGATGTTGTTAAACAACTTTGCTATGGTCTCATTTACGGCATGGGT, WBGene00055588
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region