WormMine: Gene WBGene00055750

• WormBase Gene ID: WBGene00055750
• Gene Name: Cre-hat-1
• Sequence Name: CRE04800
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable histone acetyltransferase activity and histone binding activity. Predicted to be involved in subtelomeric heterochromatin formation. Predicted to be located in nucleus. Is an ortholog of C. elegans hat-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE04800.1	CRE04800.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE04800	CRE04800		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1117119
• Remark: Cre-tag-235, ACGCATCGATGTCAAGAAACGGCTCTACGTACCCATGAAAAGATCGGATAAAGATTGGCG, WBGene00055750
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region