WormMine: Gene WBGene00055866

• WormBase Gene ID: WBGene00055866
• Gene Name: Cre-pdr-1
• Sequence Name: CRE04652
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable ubiquitin-protein transferase activity and zinc ion binding activity. Predicted to be involved in protein ubiquitination. Predicted to be located in cytosol and mitochondrion. Is an ortholog of C. elegans pdr-1. In C. elegans, pdr-1 is involved in several processes, including determination of adult lifespan; mitophagy; and negative regulation of engulfment of apoptotic cell.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE04652.1	CRE04652.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE04652	CRE04652		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1095983
• Remark: Cre-pdr-1, TAATGCAGCAACCGAAAGGAACGGTGGATGCGCCCACATTCACTGCACTTCATGTGGCAT, WBGene00055866
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region