WormMine: Gene WBGene00055887

• WormBase Gene ID: WBGene00055887
• Gene Name: Cre-set-16
• Sequence Name: CRE04664
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to be located in nucleus. Is an ortholog of C. elegans set-16. In C. elegans, set-16 is involved in programmed cell death and regulation of vulval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE04664.1	CRE04664.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE04664	CRE04664		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1093550
• Remark: Cre-set-16, CACCCAGATATTGGATGCTGGTTCCTCCGGACGTGAAAAGAAAATCATAATCACGGCTAA, WBGene00055887
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region