WormMine: Gene WBGene00056072

• WormBase Gene ID: WBGene00056072
• Gene Name: Cre-tfg-1
• Sequence Name: CRE28268
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable identical protein binding activity. Predicted to be involved in COPII vesicle coating. Is an ortholog of C. elegans tfg-1. In C. elegans, tfg-1 is involved in several processes, including endoplasmic reticulum to Golgi vesicle-mediated transport; protein localization; and regulation of cell size.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE28268.1	CRE28268.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE28268	CRE28268		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1093496
• Remark: Cre-tfg-1, CAACAAGGATTCGCTCCACCACCGCCAGTCTCCCAAGCTCCAGGAAATTTTGCTCCGCCA, WBGene00056072
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region